View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_21 (Length: 346)
Name: NF0839_low_21
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 87 - 331
Target Start/End: Complemental strand, 12684058 - 12683814
Alignment:
| Q |
87 |
gacaaggcctaataaacttagtttcaatttcttctttcagaacttcaatgccaccatcattcatcaacaaatctctatgttcaactaaaaacttttcatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12684058 |
gacaaggcctaataaacttagtttcaatttcttctttcagaacttcaatgccaccatcattcatcaacaaatctctatgttcaactaaaaacttttcatt |
12683959 |
T |
 |
| Q |
187 |
ttctaatatgtcaataatggtagcaacaaaccatgcaccttgataaccttcttcgtcgctgctaacctcaactatttccccctttttaaactttggctca |
286 |
Q |
| |
|
| ||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12683958 |
tcctaatgtgtcaataatagtagcaacaaaccaagcaccttgataaccttcttcgtcgctgctaacctcaactatttccccctttctaaactttggctca |
12683859 |
T |
 |
| Q |
287 |
ttttttggcttccctgtaaatttgaatttgattttaactttaggc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683858 |
ttttttggcttccctgtaaatttgaatttgattttaactttaggc |
12683814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University