View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_30 (Length: 320)
Name: NF0839_low_30
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 91 - 320
Target Start/End: Original strand, 9968967 - 9969196
Alignment:
| Q |
91 |
ccatctccccgccatttctcaggtgattcccacactaccatccctccatccaaaaccctacctccggccgccggagacctcccccaaacaggcgtaccac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9968967 |
ccatctccccgccatttctcaggtgattcccacactaccatccctccatccaaaaccctacctccggccaccggagacctcccccaaacaggcgtaccac |
9969066 |
T |
|
| Q |
191 |
cgccaactatctccatttcattaaaatttgacgccctaggcgtcggctgtaaggaataagcgtccgttgaagcataaccagacagctgtggacttgtcat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9969067 |
cgccaactatctccatttcattaaaattcgacgccctaggcgtcggctgcaaggaataagcgtccgttgaagcataaccagacagctgtggacttgtcat |
9969166 |
T |
|
| Q |
291 |
attatcgagaaaattccccggcgtgttgat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9969167 |
attatcgagaaaattccccggcgtgttgat |
9969196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2821 times since January 2019
Visitors: 6167