View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0839_low_33 (Length: 313)

Name: NF0839_low_33
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0839_low_33
NF0839_low_33
[»] chr5 (2 HSPs)
chr5 (30-110)||(10457500-10457579)
chr5 (266-306)||(10457306-10457346)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 110
Target Start/End: Complemental strand, 10457579 - 10457500
Alignment:
30 attttcctatatttaccttgctagctgcaactcataaatctttcaatttattannnnnnnnctcttaaaccctcggttaaa 110  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||    
10457579 attttcctatatttac-ttgctagctgcaactcataaatctttcaatttattattatttttctcttaaaccctcggttaaa 10457500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 266 - 306
Target Start/End: Complemental strand, 10457346 - 10457306
Alignment:
266 attacatattcaataatactaaaatcatactagtataatct 306  Q
    |||||||||||||||||||||||| ||||||||||||||||    
10457346 attacatattcaataatactaaaaacatactagtataatct 10457306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University