View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_33 (Length: 313)
Name: NF0839_low_33
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0839_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 110
Target Start/End: Complemental strand, 10457579 - 10457500
Alignment:
Q |
30 |
attttcctatatttaccttgctagctgcaactcataaatctttcaatttattannnnnnnnctcttaaaccctcggttaaa |
110 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
10457579 |
attttcctatatttac-ttgctagctgcaactcataaatctttcaatttattattatttttctcttaaaccctcggttaaa |
10457500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 266 - 306
Target Start/End: Complemental strand, 10457346 - 10457306
Alignment:
Q |
266 |
attacatattcaataatactaaaatcatactagtataatct |
306 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
10457346 |
attacatattcaataatactaaaaacatactagtataatct |
10457306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University