View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_41 (Length: 290)
Name: NF0839_low_41
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0839_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 36601571 - 36601316
Alignment:
Q |
1 |
ttcatgttcaccgaaaatgagtggttattctaatcttaaatgtgtgacaataaagtagtattcacttgtgagctatggtgttttaggattgccatataat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
T |
36601571 |
ttcatgttcaccgaaaatgagtggttattctaatctttaatgtgtgacaataaagtagtagtcactt--------------tttaggattgccatataat |
36601486 |
T |
 |
Q |
101 |
ttgaattaagggttaatatgcctttagcggaatcttattctgctgttaataatgaattttacctatagtctgtgctaacaattcacaagctagaatataa |
200 |
Q |
|
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
36601485 |
ttgaattaagggttaatatgcttttaggggaatcttattctgctgttaataatgaattttacctatagtccttgctaacaattcacaagctagaatataa |
36601386 |
T |
 |
Q |
201 |
agttcttcgatgccctaataaaagccatcatttgaaaacaaaccacataccggctgtttagaatggcagtt |
271 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
36601385 |
agttcttcgatg-cctaataaaagccatcatttgaaaacaaaccacataccggctgtttagaacggcagtt |
36601316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 753 times since January 2019
Visitors: 6131