View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_56 (Length: 264)
Name: NF0839_low_56
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 36601107 - 36601353
Alignment:
| Q |
18 |
cacagacgcaaaagcagccatgtagcagttatcattttttaactgatagtaactgataagaaatccaaaatttcattgaaaaacctcaacttttgacatg |
117 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601107 |
cacaaacgcaaaagcggccatgtagcagttatcattttttaactgatagtaactgataagaaatccaaaatttcattgaaaaacctcaacttttgacatg |
36601206 |
T |
 |
| Q |
118 |
atcacagagatacttacggcataatgtggatagatagatgatatgtaaaacagcagtgtgctataacccaatcaaagacaggacatgctacacaaacatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601207 |
atcacagagatacttacggcataatgtggatagatagatgatatgtaaaacagcagtgtgctataacccaatcaaagacaggacatgctacacaaacatc |
36601306 |
T |
 |
| Q |
218 |
atgtttgacaactgccattctaaacagccggtatgtggtttgttttc |
264 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36601307 |
atgtttgacaactgccgttctaaacagccggtatgtggtttgttttc |
36601353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University