View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_59 (Length: 260)
Name: NF0839_low_59
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 248
Target Start/End: Original strand, 27567276 - 27567494
Alignment:
| Q |
30 |
gaaaccaatgactaggatcatcctcgacattgcattcttttatgttgtataaacatacacaatagcaatatgttctgcttcttcaaaaaccacattgtgg |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27567276 |
gaaaccaatgacgaggatcatcctcgacattacattcttttatgttgtataaacatacacaatagcaatatgttctgcttcttcaaaaaccacattgtgg |
27567375 |
T |
 |
| Q |
130 |
caacgattcaatctcgtttgactgcgaacactttttcaggcgcataaattctcagttggtaacctttggggtgatttattcagtaattcaaattctatac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27567376 |
caacgattcaatctcgtttgactgcgaacactttttcaggcgcataaattctcagttggtaacctttggggtgatttattcagtaattcaaattctatac |
27567475 |
T |
 |
| Q |
230 |
ttaaggcatgtttattctc |
248 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27567476 |
ctaaggcatgtttattctc |
27567494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University