View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_62 (Length: 258)
Name: NF0839_low_62
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_62 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 12819336 - 12819467
Alignment:
| Q |
127 |
aaactcaacaggtcatgcaaagatatcagaaaagcaatataaggaacaatgtcaaaggaccacgacattcttcgtatgaatcagttatcattatccattg |
226 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
12819336 |
aaactcaacaggtcctgcaaagatctcagaaaagcaatataaggaacaatgtcaaaggaccacggcattcttcgtatgaatcagttatcattatcaattg |
12819435 |
T |
|
| Q |
227 |
aggtatgtatcatagagtactatgcagtatta |
258 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
12819436 |
aggtatgtatcatagcgtactatgcagtatta |
12819467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 12819183 - 12819285
Alignment:
| Q |
16 |
atcgagagtgggaaaacattcaaagagagattttcttttagtatatagatatagaccatattttctgcactattttcttgaaaacaaaagttggtgaaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12819183 |
atcgagagtgggaaaacattcaaagagagattttcttatagtatatagatatagaccatattttctgcactattttcttgaaaacaaaagttggtgaaag |
12819282 |
T |
|
| Q |
116 |
caa |
118 |
Q |
| |
|
||| |
|
|
| T |
12819283 |
caa |
12819285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2150 times since January 2019
Visitors: 6159