View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_65 (Length: 250)
Name: NF0839_low_65
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0839_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 39300170 - 39299932
Alignment:
Q |
1 |
atattggtggaagaggaagatcaagagagactcatgaacttggttcaaatgtgaagcagagtgatagggatcatcatcatgctgctgctaccaaccttgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
39300170 |
atattggtggaagaggaagatcaagagagactcatgaacttggttcaaatgtgaagcagagtgatagggatcatcatcatgctgctgctacgaaccttgg |
39300071 |
T |
 |
Q |
101 |
acacaaacaaggttttcagtctcactctgatcaaaatgtgaaacagagtgagagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgca |
200 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39300070 |
tcacaagcaaggttttcagtctcactctgatcaaaatgtgaaacagagtgagagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgca |
39299971 |
T |
 |
Q |
201 |
gaaggcatgaaagaaagaggtgaaggtttgggagatatt |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39299970 |
gaaggcatgaaagaaagaggtgaaggtttgggagatatt |
39299932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39299936 - 39299888
Alignment:
Q |
1 |
atattggtggaagaggaagatcaagagagactcatgaacttggttcaaa |
49 |
Q |
|
|
|||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
T |
39299936 |
atattggtggaagaggaagagaaagagagagccatgaacttggttcaaa |
39299888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1621 times since January 2019
Visitors: 6145