View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_66 (Length: 248)
Name: NF0839_low_66
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 28522162 - 28521946
Alignment:
| Q |
1 |
tttaactttcacaattactttgaagcttctcttctgcannnnnnnatcaaaactaaggacactaggcttcactgtgatttcatctccttttggtgatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28522162 |
tttaactttcacaattactttgaagcttctcttctgcatttttttatcaaaactaaggacactaggcttcactgtgatttcaactccttttggtgatcta |
28522063 |
T |
 |
| Q |
101 |
atagtagcattgtaggtaattggaacaggacctacattggtcactgttctcctaaaaactccagtttgtttctctttcttgctttccaagctaagttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28522062 |
atagtagcattgtaggtaattggaacaggacctacattggtcactgttcttctaaaaactccaatttgtgtctctttcttgctttccaagctaagttgca |
28521963 |
T |
 |
| Q |
201 |
tggttggatagttgata |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28521962 |
tggttggatagttgata |
28521946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 162
Target Start/End: Complemental strand, 34294585 - 34294486
Alignment:
| Q |
63 |
taggcttcactgtgatttcatctccttttggtgatctaatagtagcattgtaggtaattggaacaggacctacattggtcactgttctcctaaaaactcc |
162 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||| |||| |||||||| || | |||| |||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
34294585 |
taggcttcactgtaatttccacaccttttggtgatttaatggtagcattatacattgttggtccaggacctacattggtaactcttctcctgaaaactcc |
34294486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University