View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0839_low_70 (Length: 241)

Name: NF0839_low_70
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0839_low_70
NF0839_low_70
[»] chr5 (1 HSPs)
chr5 (4-145)||(27567116-27567257)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 4 - 145
Target Start/End: Complemental strand, 27567257 - 27567116
Alignment:
4 gaaattagaccatgcatcaaattaaggaccatcacgtgtgtgaatgaagacccttagttcctttcactcatttcttctgctctgtgaactacatggtgaa 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27567257 gaaattagaccatgcatcaaattaaggaccatcacgtgtgtgaatgaagacccttagttcctttcactcatttcttctgctctgtgaactacatggtgaa 27567158  T
104 caagtgttacttgggcattgattttgacggccctttgcttct 145  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
27567157 caagtgttacttgggcattgattttgacggccctttgtttct 27567116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University