View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0840_high_14 (Length: 263)

Name: NF0840_high_14
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0840_high_14
NF0840_high_14
[»] chr4 (1 HSPs)
chr4 (30-263)||(43867317-43867550)


Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 43867550 - 43867317
Alignment:
30 taacaaggggcgaaaaacttttaagtttggatcaatgaagtccgagtgcagatatgtctcgcgctagtatgtccatgagctatagttcaaccgataaaaa 129  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
43867550 taacaaggggtgaaaaacttttaagtttggatcaatgaagtccgagtgcagatatgtctcgcgctagtatgtccatgagctatagttcaactgataaaaa 43867451  T
130 tgtcgaattgttaagttggatgctatggccggggctggaactccggcaatctcgactcctccacttatgtgtttgagttttcaatagctactgacatttc 229  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43867450 tgtcgaattgttaagttggatgctatggccgcggctggaactccggcaatctcgactcctccacttatgtgtttgagttttcaatagctactgacatttc 43867351  T
230 gtctatccactaaataaattacggagggagtata 263  Q
    ||||||||||||||||||||||||||||||||||    
43867350 gtctatccactaaataaattacggagggagtata 43867317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1642 times since January 2019
Visitors: 6145