View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_high_16 (Length: 253)
Name: NF0840_high_16
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 2833221 - 2833085
Alignment:
| Q |
13 |
aatatagaagaacaatggaaacaaataaagggtagaagagaagttttgatatcatcacctaaataaagttagagagaatgaaaggcaagtctggtttgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2833221 |
aatatagaagaacaatggaaacaaataaagggtagaagagaagtattgatatattcacctaaatagagttagagagaatgaaaggcaagtctggtttgaa |
2833122 |
T |
 |
| Q |
113 |
gaattaatcatttgatgtcgtttcatatgaaaatgag |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833121 |
gaattaatcatttgatgtcgtttcatatgaaaatgag |
2833085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University