View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0840_high_21 (Length: 212)

Name: NF0840_high_21
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0840_high_21
NF0840_high_21
[»] chr4 (2 HSPs)
chr4 (56-120)||(25892468-25892532)
chr4 (1-55)||(25892393-25892446)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 56 - 120
Target Start/End: Original strand, 25892468 - 25892532
Alignment:
56 aaaggttcgagaaatcttgagttggaatagttcattagtagttagtaagtcttgttatctctgct 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25892468 aaaggttcgagaaatcttgagttggaatagttcattagtagttagtaagtcttgttatctctgct 25892532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 25892393 - 25892446
Alignment:
1 tggaaaatcttgtatatttagaatgcttttcatgctgaacttataagagctatgc 55  Q
    ||||||||||||  ||||| |||||||||||||||||||||||||||||||||||    
25892393 tggaaaatcttgg-tatttggaatgcttttcatgctgaacttataagagctatgc 25892446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University