View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_high_6 (Length: 384)
Name: NF0840_high_6
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_high_6 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 4 - 195
Target Start/End: Complemental strand, 42169463 - 42169271
Alignment:
| Q |
4 |
gtgtagccatggattatt-attacctatggtgagtttcagctatacccatcatagtaagataatggctgaaagcacgagcaagagtgaaagcttcttcta |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169463 |
gtgtagccatggattatttattacctatggtgagtttcagctatacccatcatagtaagataatggctgaaagcacgagcaagagtgaaagcttcttcta |
42169364 |
T |
|
| Q |
103 |
atgacatctttgacaactctgaagctaactgcttctcaagtaactcagccatgttcactatacctgcttgcctcatattgcatgcactctgcc |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169363 |
atgacatctttgacaaatctgaagctaactgcttctcaagtaactcagccatgttcactatacctgcttgcctcatattgcatgcactctgcc |
42169271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 42169253 - 42169212
Alignment:
| Q |
213 |
tagaaacatcattcactagcactcacttatcaaaggcgtgtc |
254 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
42169253 |
tagaaacatcattcactattactcacttatgaaaggcgtgtc |
42169212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 92 - 195
Target Start/End: Original strand, 21686047 - 21686150
Alignment:
| Q |
92 |
agcttcttctaatgacatctttgacaactctgaagctaactgcttctcaagtaactcagccatgttcactatacctgcttgcctcatattgcatgcactc |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
21686047 |
agcttcttctaaagacatctttgacaactctgaagctaactgcttctcaattaactcagccatgttcactatacctgcttgcctcatattacatccactc |
21686146 |
T |
|
| Q |
192 |
tgcc |
195 |
Q |
| |
|
|||| |
|
|
| T |
21686147 |
tgcc |
21686150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 7725551 - 7725600
Alignment:
| Q |
19 |
attattacctatggtgagtttcagctatacccatcatagtaagataatgg |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
7725551 |
attattacctatggtgagtttcagctatatcagtcacagtaagataatgg |
7725600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 33 - 139
Target Start/End: Complemental strand, 333947 - 333841
Alignment:
| Q |
33 |
tgagtttcagctatacccatcatagtaagataatggctgaaagcacgagcaagagtgaaagcttcttctaatgacatctttgacaactctgaagctaact |
132 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| || ||||| ||||||||||| || |||||||||||| |||||| || ||||||||||| |||| |
|
|
| T |
333947 |
tgagtttcagctatgctcatcatagtaagatagtgactgaatgcacgagcaagtgtttgagcttcttctaagttcatcttggataactctgaagccaact |
333848 |
T |
|
| Q |
133 |
gcttctc |
139 |
Q |
| |
|
||||||| |
|
|
| T |
333847 |
gcttctc |
333841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1150 times since January 2019
Visitors: 6137