View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_high_9 (Length: 309)
Name: NF0840_high_9
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0840_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 30 - 301
Target Start/End: Complemental strand, 29206293 - 29206005
Alignment:
Q |
30 |
ttaacaaccccattaaatagaagctttatacagttgcgaagagaagcatctataatgtcacattaatttcatgcatgtt----------------atgcc |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
29206293 |
ttaacaaccccattaaatagaagctttatacagttgcgaagagaagcatctataatgtcacattaatttcatgcatgttgtacactatccatgccatgcc |
29206194 |
T |
 |
Q |
114 |
atagagagaaaacttgagagcttttgtaccatatagcctagctccacttaattagacggcgagannnnnnnnnnnnnnnnnnatgtattctttgtcacaa |
213 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
29206193 |
atagagagaaaacttaagagcttttgtaccatatagcctagctccacttaattagacggcgaga-tttttttatttttttttatgtattctttgtcacaa |
29206095 |
T |
 |
Q |
214 |
ataataaagatgaatcgtgttttttgtgtcctttgattaaggatctttacataccatacc--aattggaaatgaactgaatagaattatc |
301 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
29206094 |
ataataaagatgaatcgtgttttttgtgtcctttgattaaggatctttacataccatgccttgtttggaaatgaactgaatagaattatc |
29206005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 800 times since January 2019
Visitors: 6131