View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_12 (Length: 424)
Name: NF0840_low_12
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 20914858 - 20914770
Alignment:
| Q |
151 |
gctggttgtgcgtgtggctgctacctggttaggcagcagattactgctatagctttggttactgcagagttg-tttgtttgtgcgcaac |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
20914858 |
gctggttgtgcgtgtggctgctacctggttaggcagcagattactgctatagctttggatgctgcagagttgttttgtttgtgcgcaac |
20914770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 16673169 - 16673227
Alignment:
| Q |
62 |
ttctgattttttgtagggtgttgtcatgttaccaaacatgtttgccaatgatttcagag |
120 |
Q |
| |
|
||||| ||| || ||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
16673169 |
ttctgttttattttagggtgttgtcaagttaccaaacatgtttgcagctgatttcagag |
16673227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 17647537 - 17647595
Alignment:
| Q |
62 |
ttctgattttttgtagggtgttgtcatgttaccaaacatgtttgccaatgatttcagag |
120 |
Q |
| |
|
||||| ||| || ||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17647537 |
ttctgttttattttagggtgttgtcaagttaccaaacatgtttgcagctgatttcagag |
17647595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University