View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0840_low_21 (Length: 315)

Name: NF0840_low_21
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0840_low_21
NF0840_low_21
[»] chr2 (1 HSPs)
chr2 (20-178)||(40694821-40694986)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 40694986 - 40694821
Alignment:
20 atactctactattgtactttactatatagcttaactactttatatgtctcttgatgttttcttac-----aaagtgtaataggttggatcatctcttgtt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||     
40694986 atactctactattgtactttactatatagcttaactactttatatgtctcttgatgttttcttacaaattaaagtgtaataggttggatcatctcttgta 40694887  T
115 tatttttgaagcaatactcttttctt--tctcaatgaaacatccaaattttcacattttagtaaaa 178  Q
    ||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||    
40694886 tatttttgaagcaatactcttttttttctctcaatgaaacatccaaattttcacattttagtaaaa 40694821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University