View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_26 (Length: 295)
Name: NF0840_low_26
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0840_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 85 - 199
Target Start/End: Complemental strand, 16427128 - 16427014
Alignment:
Q |
85 |
acatcatcagaaccaaaagaagataacaaattctcaaactcatcttccataacaccttcaacatcccacaaaacaccgtccattttcacaaacgaatcat |
184 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16427128 |
acatcatctgaaccaaaagaagataacaaattctcaaactcatcttccataacaccttcaacatcccacaaaacaccgtccattttcacaaacgaatcat |
16427029 |
T |
 |
Q |
185 |
caatcgttacactgt |
199 |
Q |
|
|
||||||||||||||| |
|
|
T |
16427028 |
caatcgttacactgt |
16427014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 321 times since January 2019
Visitors: 6128