View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_30 (Length: 281)
Name: NF0840_low_30
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0840_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 43485057 - 43484820
Alignment:
Q |
29 |
aaatataaaattatcggtgaagttagtatagaaaaatgaaatttctctttaattctttggtcattaaatttagtgatgaatttagagtgatttcacattt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
T |
43485057 |
aaatataaaattatcggtgaagttagtatagaaaaatgaaatttctttttaattctttggtcactaaatttagtgatgaatttagagtgatttcacgttt |
43484958 |
T |
 |
Q |
129 |
tctttctctaaatttctttcgttaattttatgtaactattatagtctataatcttgtttccgtgatctaaaatttcttgatccatcgttgtctcttgcaa |
228 |
Q |
|
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||| |
|
|
T |
43484957 |
tctttctctaaatttcttccgttaattttatataactattatagtctataatcttgtttccgtgagctaaaatttcttgatccgtcgctgtctcttgcaa |
43484858 |
T |
 |
Q |
229 |
tgattttatcaattatctttaatgctttgatccattat |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
43484857 |
tgattttatcaattatctttaatgctttgatccattat |
43484820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 115
Target Start/End: Complemental strand, 20088496 - 20088436
Alignment:
Q |
55 |
tatagaaaaatgaaatttctctttaattctttggtcattaaatttagtgatgaatttagag |
115 |
Q |
|
|
|||| |||||| ||||||||| | ||||||||||||| ||||||||||||| | |||||| |
|
|
T |
20088496 |
tataaaaaaataaaatttctcataaattctttggtcacaaaatttagtgatggaattagag |
20088436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University