View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_34 (Length: 263)
Name: NF0840_low_34
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 388383 - 388569
Alignment:
| Q |
37 |
catcaccatggtcaccactataaaatcctatttttatatcagcgaaaccatagtcctttgattcgacgaaactaactggaataactgaactccatctaga |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388383 |
catcaccatggtcaccactataaaatcctatttttatatcagcgaaaccatagtcctctgattcgacgaaactaactggaataactgaactccatctaga |
388482 |
T |
|
| Q |
137 |
gaaagctcgtttgaatgcttctcttatctcttgtatgctcaagttatgaatcatgtagtcacttgagaagccataggttagtgtcat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388483 |
gaaagctcgtttgaatgcttctcttatctcttgtatgctcaagttatgaatcatgtagtcacttgagaagccataggttagtgtcat |
388569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 940 times since January 2019
Visitors: 6134