View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_35 (Length: 263)
Name: NF0840_low_35
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0840_low_35 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 43867550 - 43867317
Alignment:
Q |
30 |
taacaaggggcgaaaaacttttaagtttggatcaatgaagtccgagtgcagatatgtctcgcgctagtatgtccatgagctatagttcaaccgataaaaa |
129 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
43867550 |
taacaaggggtgaaaaacttttaagtttggatcaatgaagtccgagtgcagatatgtctcgcgctagtatgtccatgagctatagttcaactgataaaaa |
43867451 |
T |
 |
Q |
130 |
tgtcgaattgttaagttggatgctatggccggggctggaactccggcaatctcgactcctccacttatgtgtttgagttttcaatagctactgacatttc |
229 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43867450 |
tgtcgaattgttaagttggatgctatggccgcggctggaactccggcaatctcgactcctccacttatgtgtttgagttttcaatagctactgacatttc |
43867351 |
T |
 |
Q |
230 |
gtctatccactaaataaattacggagggagtata |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
43867350 |
gtctatccactaaataaattacggagggagtata |
43867317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University