View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_40 (Length: 250)
Name: NF0840_low_40
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 17724929 - 17725006
Alignment:
| Q |
1 |
aatttttctgtttggatcattgcataattttggttgacatgaaagaactgttgaattgatttatgttgattggtgtgg |
78 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17724929 |
aatttttgtgtttggatcattgcataattttggtcgacatggaagaactgttgaattgatatatgttgattggtgtgg |
17725006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 17725049 - 17725115
Alignment:
| Q |
119 |
atgaattgattggtggtactagtgcaaggttgattacagtggaaatataatgaaa-aacacccactt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17725049 |
atgaattgattggtggtactagtgcaaggttgattacagtggaaatataatgaaataacacccactt |
17725115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 235
Target Start/End: Original strand, 41225946 - 41225996
Alignment:
| Q |
185 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcag |
235 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41225946 |
gaggagttggtgagggagtgctctgtttttttgcataatattgttttgcag |
41225996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 246
Target Start/End: Original strand, 36480871 - 36480932
Alignment:
| Q |
185 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcagaataatctacc |
246 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
36480871 |
gaggatttggtgaaggagagctctgtatttttgcataatattattttgcaggataatgtacc |
36480932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 45814551 - 45814495
Alignment:
| Q |
185 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcagaataat |
241 |
Q |
| |
|
|||||| |||||||||||||||||| ||| | ||||||| ||||||||||| ||||| |
|
|
| T |
45814551 |
gaggatatggtgagggagtgctctgtattatagcataattttgttttgcaggataat |
45814495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University