View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_43 (Length: 231)
Name: NF0840_low_43
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 35154920 - 35154789
Alignment:
| Q |
1 |
tttacgtcgattttttcaatcatttgaaccaaatcttcttcagagatgcaaattccaagattttgtaatgagtcgctaagctctttctttgtaatacgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35154920 |
tttacgtcgattttttcaatcatttgaaccaaatcttcttcagagatgcaaattccaagattttgtaatgagtcgctaagctctttctttgtaatacgac |
35154821 |
T |
 |
| Q |
101 |
catccccatttttgtcgaacatttgaaaaatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35154820 |
catccccatttttgtcgaacatttgaaaaatt |
35154789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 18520237 - 18520367
Alignment:
| Q |
1 |
tttacgtcgattttttcaatcatttgaacca-aatcttcttcagagatgcaaattccaagattttgtaatgagtcgctaagctctttctttgtaatacga |
99 |
Q |
| |
|
||||||| |||||||||||||||||||| | || || || |||||||||||| |||| ||||| ||| | ||| ||||||||||| ||| |||||||| |
|
|
| T |
18520237 |
tttacgttgattttttcaatcatttgaaaaataaaattgttgagagatgcaaatcccaaaattttataacgggtctctaagctcttt-tttataatacga |
18520335 |
T |
 |
| Q |
100 |
ccatccccatttttgtcgaacatttgaaaaat |
131 |
Q |
| |
|
||||||| |||| | ||| ||||||||||| |
|
|
| T |
18520336 |
ccatccctatttcaattgaagatttgaaaaat |
18520367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University