View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_46 (Length: 212)
Name: NF0840_low_46
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0840_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 56 - 120
Target Start/End: Original strand, 25892468 - 25892532
Alignment:
| Q |
56 |
aaaggttcgagaaatcttgagttggaatagttcattagtagttagtaagtcttgttatctctgct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25892468 |
aaaggttcgagaaatcttgagttggaatagttcattagtagttagtaagtcttgttatctctgct |
25892532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 25892393 - 25892446
Alignment:
| Q |
1 |
tggaaaatcttgtatatttagaatgcttttcatgctgaacttataagagctatgc |
55 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25892393 |
tggaaaatcttgg-tatttggaatgcttttcatgctgaacttataagagctatgc |
25892446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University