View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0840_low_47 (Length: 203)
Name: NF0840_low_47
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0840_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 12316283 - 12316343
Alignment:
Q |
16 |
gtgcacttgaattgtgctatgtaaaactcattttacgattcatttcaatacctttcaattt |
76 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12316283 |
gtgcacttgaattgtgttatgtaaaactcattttacgattcatttcaatacctttcaattt |
12316343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 183
Target Start/End: Original strand, 12316414 - 12316455
Alignment:
Q |
142 |
gattattttatactagttcacaatttaatcgatttgctacct |
183 |
Q |
|
|
||||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
12316414 |
gattattttatactagttcacaacttaatcggtttgctacct |
12316455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University