View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0840_low_47 (Length: 203)

Name: NF0840_low_47
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0840_low_47
NF0840_low_47
[»] chr8 (2 HSPs)
chr8 (16-76)||(12316283-12316343)
chr8 (142-183)||(12316414-12316455)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 12316283 - 12316343
Alignment:
16 gtgcacttgaattgtgctatgtaaaactcattttacgattcatttcaatacctttcaattt 76  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
12316283 gtgcacttgaattgtgttatgtaaaactcattttacgattcatttcaatacctttcaattt 12316343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 183
Target Start/End: Original strand, 12316414 - 12316455
Alignment:
142 gattattttatactagttcacaatttaatcgatttgctacct 183  Q
    ||||||||||||||||||||||| ||||||| ||||||||||    
12316414 gattattttatactagttcacaacttaatcggtttgctacct 12316455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University