View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841-Insertion-10 (Length: 69)
Name: NF0841-Insertion-10
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841-Insertion-10 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 9e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 9e-26
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 31474228 - 31474166
Alignment:
Q |
7 |
aataatatcagtgggaaataccttgctgccagtatatggaatctttattgggaggttctgtga |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
31474228 |
aataatatcagtgggaaataccttgctgccagtatatggaatctttattgggaggttccgtga |
31474166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 40841798 - 40841736
Alignment:
Q |
7 |
aataatatcagtgggaaataccttgctgccagtatatggaatctttattgggaggttctgtga |
69 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
40841798 |
aataatatcagtggcaaataccttgctgccagtatatggaatctttattgggaggttccgtga |
40841736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University