View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841-Insertion-5 (Length: 299)
Name: NF0841-Insertion-5
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841-Insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 275
Target Start/End: Complemental strand, 45269100 - 45268836
Alignment:
Q |
8 |
gaatactaaactatggcttttcacattccatgttacggaaactgagaggggggtgtgacgtactcttttttattttgtggtggcttttgaaatttgagat |
107 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| |||||||||| | || ||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
45269100 |
gaatactaaactatggcttttcacattccatattagggaaactgagtgaggagtgtgac--actcttttttattttgtggtggcatttgaaatttgagat |
45269003 |
T |
 |
Q |
108 |
tgattcgtaaactcttgagtagcctgtactagcctagctactcttttctgcaaaccaaagctcagggcttcgtggaagttggaacaagtaatcgacagtc |
207 |
Q |
|
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
T |
45269002 |
tgattcgtaaactcttgtgtagcctgtactaccctagctactcttttctgcaaaccaaagctcagggcttcttggaagttggaacaagtaatcgaaagtc |
45268903 |
T |
 |
Q |
208 |
acattaagagtgattaaatgatttctaatgaattgcatattatacgtagggaccgggattcgaacctc |
275 |
Q |
|
|
||||||| ||||||||||||||||| |||||||||||||||||| | || ||||||| |||||||||| |
|
|
T |
45268902 |
acattaaaagtgattaaatgatttccaatgaattgcatattatatgcagagaccggg-ttcgaacctc |
45268836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University