View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841-Insertion-7 (Length: 134)
Name: NF0841-Insertion-7
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841-Insertion-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 34473740 - 34473614
Alignment:
| Q |
8 |
cgtcggtattctccgataagaggcaccggaggagaatcgtttcacggtcatctggacgtcggagcgttcaagttcaagcagtgatcagcggcggagacag |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34473740 |
cgtcggtattctccgataagaggcaacggaggagaatcatttcacggtcatctggatggcggagcgttcaagttcaagcagtgatcagcggcggagacag |
34473641 |
T |
 |
| Q |
108 |
caagactacgaccttatctccggtgga |
134 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
34473640 |
caagactacgacctcatctccggtgga |
34473614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University