View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_20 (Length: 468)
Name: NF0841_high_20
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 215 - 456
Target Start/End: Original strand, 33112816 - 33113057
Alignment:
| Q |
215 |
ttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatttctttca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112816 |
ttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatttctttca |
33112915 |
T |
 |
| Q |
315 |
tatgatatgaatgtgtattctttatatgtgttttaatttaatttctatgtacatacgtttctgtttaacactctgtacaacnnnnnnnnnnncctatggt |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
33112916 |
tatgatatgaatgtgtattctttatatgtgttttaatttaatttctatgtacatacgtttctgtttaacactctgtacaacaacaaaaaaaacctatgct |
33113015 |
T |
 |
| Q |
415 |
tctctcttttgttaaacaagttcaatttttctataccatatt |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33113016 |
tctctcttttgttaaacaagttcaatttttctataccatatt |
33113057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 33112647 - 33112697
Alignment:
| Q |
37 |
gttttcctatgtttcaatctctcatgttatcaaccatttgtctatgtaaca |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
33112647 |
gttttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca |
33112697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 21562557 - 21562499
Alignment:
| Q |
225 |
tgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgata |
283 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || ||||||||||| || ||||| |||| |
|
|
| T |
21562557 |
tgcaggagtcatatctggggctcttttgtatataagagatgattttaaggctgtggata |
21562499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University