View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_31 (Length: 414)
Name: NF0841_high_31
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 29 - 242
Target Start/End: Complemental strand, 46863349 - 46863137
Alignment:
| Q |
29 |
agatgagaatattggtagaaaaacatcatgggatgatcaaagtttaaggtttgaggtannnnnnnnncatgggttcacgttcaccgccggtgtttataaa |
128 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46863349 |
agatgagaatattggtagaaaaaattcatgggatgatcaaagtttaaggtttgaggtatttttttt-catgggttcacgttcaccgccggtgtttataaa |
46863251 |
T |
 |
| Q |
129 |
gaaagagacaaaattggaatatgtagtgactagtgaggcagtgacgaggtttaaggttttatagttgggaccaccaagtcaaaaccctagccacaactat |
228 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46863250 |
gaaagagacaaaattggagtatgtagtgactagtgaggcagtgacgaggtttaaggttttttagttgggaccaccaagtcaaaaccctagccacaactat |
46863151 |
T |
 |
| Q |
229 |
tacactatcctttc |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46863150 |
tacactatcctttc |
46863137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 310 - 400
Target Start/End: Complemental strand, 46863140 - 46863050
Alignment:
| Q |
310 |
tttcatgttgtctttgagtacgattaaggaagagtttttattttctatcatattttataaatgggttaattaagtttgtgtttggttgagt |
400 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46863140 |
tttcatgttgtctttgggtacgattaaggaagagtttttattttctatcatattttataaatgggttaattaagtttgtgtttggttgagt |
46863050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University