View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_48 (Length: 285)
Name: NF0841_high_48
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 36326846 - 36326720
Alignment:
Q |
40 |
tactagtattcacaggtggaattgttagttgatttattttaggcttaataaaaatgctatctttaatttatgtttaagcggataaggtagtggcaaagaa |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36326846 |
tactagtattcacaggtggaattgttagttgatttattttaggcttaataaaaatgctatctttaatttatgtttaagcggataaggtagtggcaaagaa |
36326747 |
T |
 |
Q |
140 |
gaatatgatatcttggacatttatttt |
166 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
36326746 |
gaatatgatatcttggacatttatttt |
36326720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 159 - 278
Target Start/End: Complemental strand, 36326693 - 36326574
Alignment:
Q |
159 |
tttattttgatgaattgttttttggcctagtgaatgtgagttgactatggtcgtaagctttaacaattgatgttttcgatgcgaattggaccatatagta |
258 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
T |
36326693 |
tttattttgatgaattgttttttggccgagtgaatgtgagttgactatggtcataagctttaacaattgatgttttagatgcgaattggatcatatagta |
36326594 |
T |
 |
Q |
259 |
tttaagttgaattcatctca |
278 |
Q |
|
|
||||||||||| || ||||| |
|
|
T |
36326593 |
tttaagttgaactcttctca |
36326574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University