View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_49 (Length: 279)
Name: NF0841_high_49
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 27 - 151
Target Start/End: Complemental strand, 29569428 - 29569304
Alignment:
| Q |
27 |
ctaaactgacattatgcaatgcagactgaaaaatttaaagagtatttttagatggttgtgaggaatactgatcattatacgaaagttttgcatattctaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29569428 |
ctaaactgacattatgcaatgcagactgaaaaatttaaagagtatttttagatggttgtgaggaataccgatcattatacgaaagtttcacatattctaa |
29569329 |
T |
 |
| Q |
127 |
acaactgtcatcaaaacaaaggagt |
151 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29569328 |
acaactgtcatcaaaacaaaggagt |
29569304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 137 - 233
Target Start/End: Original strand, 27917980 - 27918077
Alignment:
| Q |
137 |
tcaaaacaaaggagtgatgtctcttgtttataaattcatttt-aacttttattttatcaaatgtgaaactcttataaaatttgttaaagtggatttcg |
233 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||| || |||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27917980 |
tcaaaacaaaggagtgatgtcacttatttataaattcattttcaagttttatcttatcaaatgtgaaactcttaacaaatttgttaaagtggatttcg |
27918077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University