View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_52 (Length: 272)
Name: NF0841_high_52
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 50 - 154
Target Start/End: Complemental strand, 39583303 - 39583199
Alignment:
| Q |
50 |
tggtgtgacattctcatctcttgtgccagccagcaatgataacatgtgcttttgcattggagacagagagaaggactaaaacaaaacatgttctatgtgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583303 |
tggtgtgacattctcatctcttgtgccagccagcaatgataacatgtgcttttgcattggaggcagagagaaggactaaaacaaaacatgttctatgtgt |
39583204 |
T |
 |
| Q |
150 |
gaaac |
154 |
Q |
| |
|
||||| |
|
|
| T |
39583203 |
gaaac |
39583199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 206 - 272
Target Start/End: Complemental strand, 39583154 - 39583088
Alignment:
| Q |
206 |
tttcttgcactcatatcatatgcaaatatactattgacgtgcgtctgtagttgaaaatttgaacata |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583154 |
tttcttgcactcatatcatatgcaaatatactattgacgtgcgtctgtagttgaaaatttgaacata |
39583088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University