View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_64 (Length: 251)
Name: NF0841_high_64
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_high_64 |
 |  |
|
[»] scaffold0244 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 218
Target Start/End: Original strand, 2332388 - 2332601
Alignment:
Q |
5 |
actatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcata |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2332388 |
actatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcata |
2332487 |
T |
 |
Q |
105 |
ttgttgggcatgatgtatgggaaatggtgtctgcctgtttggtgctttttcttccggcgttattgatcatactcttgtagagaccttggttgttctcatc |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2332488 |
ttgttgggcatgatgtatgggaaatggtgtctgcctgtttggtgctttttcttccggcgttattgatcatactcttgtagagaccttggttgttctcatc |
2332587 |
T |
 |
Q |
205 |
ccgaaaattgatat |
218 |
Q |
|
|
| |||||||||||| |
|
|
T |
2332588 |
ctgaaaattgatat |
2332601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 1261909 - 1261795
Alignment:
Q |
20 |
aaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcatattgttgggcatgatg |
119 |
Q |
|
|
|||||| |||||||| | ||||||||||||||||||| || | ||||| |||||||| || |||| ||||| || |||||||||||||||| |||||| |
|
|
T |
1261909 |
aaagatgctattttctcaatgcactcttacaaagccccgggtccagatggttttcaacctatttttttcaaaacttattggcatattgttggggatgatg |
1261810 |
T |
 |
Q |
120 |
tatgggaaatggtgt |
134 |
Q |
|
|
| ||| ||||||||| |
|
|
T |
1261809 |
tgtggaaaatggtgt |
1261795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 16604 - 16490
Alignment:
Q |
20 |
aaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcatattgttgggcatgatg |
119 |
Q |
|
|
|||||| |||||||| | ||||||| ||||||||||| || | ||||| |||||||| || |||| |||| || |||||||| ||||||| |||||| |
|
|
T |
16604 |
aaagatgctattttctcaatgcacttttacaaagccccgggtccagatggttttcaacctatttttttcaaagcttattggcatagtgttggggatgatg |
16505 |
T |
 |
Q |
120 |
tatgggaaatggtgt |
134 |
Q |
|
|
| ||| ||||||||| |
|
|
T |
16504 |
tctggaaaatggtgt |
16490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3531 times since January 2019
Visitors: 6174