View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_65 (Length: 251)
Name: NF0841_high_65
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 25714131 - 25714374
Alignment:
| Q |
1 |
atagttctgtttattagaactgaatagtaa----taatattgttattatttgtttgatatgaagttgtaatagtagtatacatttttgaaagagtaatag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25714131 |
atagttctgtttattagaactgaatagtaagtaataatattgttattatttgtt-gatatgaagttgtaatagtagtatacatttttgaaagagtaatag |
25714229 |
T |
|
| Q |
97 |
tagtatacatataaaaataattatacaagtgtaccacttttttatgttttggttttatctggggttattcagtcttgcttcaaaccatcacctcatgaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
25714230 |
tagtatacatataaaaataattatacaagtgtaccacttttttatgttttggttttatctggggttgttcagtcttggctcaaaccatcaccttatgaaa |
25714329 |
T |
|
| Q |
197 |
tgcatattgtatattaactaattagatgtataaactcttcctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25714330 |
tgcatattgtatattaactaattagatgtataaactcttcctatg |
25714374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2118 times since January 2019
Visitors: 6159