View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_high_68 (Length: 244)
Name: NF0841_high_68
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_high_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 4785229 - 4785382
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaagcttgttggtacca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4785229 |
gatggaaatcaacgaatgtcgatgagtgatgtggttgcgacattagagtttgcattgcagttagagatgagtgaggaggatagtaagcttgttggtacca |
4785328 |
T |
|
| Q |
101 |
aggaaaaggaaaagagtaagcaaaggatagaattggcacattttactgatgatg |
154 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4785329 |
aggaaaaggaaaagagtgagcaaaggatagaattgtcacattttactgatgatg |
4785382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 4817658 - 4817811
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaagcttgttggtacca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817658 |
gatggaaatcaacgaatgtcgatgagtgatgtggttgcgacattagagtttgcattgcagttagagatgagtgaggaggatagtaagcttgttggtacca |
4817757 |
T |
|
| Q |
101 |
aggaaaaggaaaagagtaagcaaaggatagaattggcacattttactgatgatg |
154 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4817758 |
aggaaaaggaaaagagtgagcaaaggatagaattgtcacattttactgatgatg |
4817811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 4862611 - 4862525
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaag |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
4862611 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaagatactaag |
4862525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 4698584 - 4698670
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaag |
87 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
4698584 |
gatggaaatcaacggatgtcgatgagtgatgttgttggagctttagagtttgcattgcagttggagataagtgaggaggatactaag |
4698670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 4713460 - 4713546
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaag |
87 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||||||| |||| ||| | |||| ||||||| ||||||| ||||| |
|
|
| T |
4713460 |
gatggaaatcaacgaatgtctatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggaggatggtaag |
4713546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 4854830 - 4854916
Alignment:
| Q |
1 |
gatggaaatcaacgaatgtcaatgagtgatgttgttggagctttagagtttgcattgcagttggagatgagtgaggaggatagtaag |
87 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||| |||||||| |||| ||| | |||| ||||||| |||| |||||||| |
|
|
| T |
4854830 |
gatggaaatcaacggatgtctatgagtgatgtggttggaactttagagcttgcgttgaaattggttatgagtggggagaatagtaag |
4854916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1495 times since January 2019
Visitors: 6143