View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_high_78 (Length: 211)

Name: NF0841_high_78
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_high_78
NF0841_high_78
[»] chr4 (1 HSPs)
chr4 (13-79)||(25713662-25713728)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 13 - 79
Target Start/End: Original strand, 25713662 - 25713728
Alignment:
13 ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacctttg 79  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
25713662 ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacctttg 25713728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University