View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_101 (Length: 233)
Name: NF0841_low_101
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 73 - 201
Target Start/End: Complemental strand, 25691420 - 25691292
Alignment:
| Q |
73 |
agggatggttagtacttgtagttgtttacttgtttgattataatgtgaatgcaaaaaataagatgagatagcattgaagagatattaagacctgcatgaa |
172 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25691420 |
agggatggttattacttgtagctgtttacttgcttgattataatgtgaatgcaaaaaataagatgagatagcattgaagagatattaagacctgcatgaa |
25691321 |
T |
|
| Q |
173 |
gacattgatcatgttggtatggcaagact |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25691320 |
gacattgatcatgttggtatggcaagact |
25691292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2448 times since January 2019
Visitors: 6162