View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_104 (Length: 224)
Name: NF0841_low_104
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 104 - 210
Target Start/End: Original strand, 22047339 - 22047445
Alignment:
| Q |
104 |
aatttgtaaaaatgtttggctaaactgaaccatcaatatctctgcttattaatgaaatagtagtattggaaaaattaagtggtatatggcatgcttggtt |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22047339 |
aatttgtaaaaatgtttggctaatctgaaccatcaatatctctgcttattaatgaaatagcagtattggaaaaattaagtggtatatggcatgcttggtt |
22047438 |
T |
|
| Q |
204 |
ttatttt |
210 |
Q |
| |
|
||||||| |
|
|
| T |
22047439 |
ttatttt |
22047445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2189 times since January 2019
Visitors: 6159