View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_105 (Length: 215)
Name: NF0841_low_105
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_low_105 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 26217738 - 26217626
Alignment:
Q |
103 |
ccttcatcataaagaaacccataagaaagggtccccttgttgaagacctcttgcaagtatgatagggtccactacacttctattaacaatgacggagtaa |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
26217738 |
ccttcatcataaagaaacccataagaaagggtccccttgttgaagacctcttgcaagtatgacagggtccactacacttctattaacaatgacggagtaa |
26217639 |
T |
 |
Q |
203 |
tccataattcaaa |
215 |
Q |
|
|
||||||||||||| |
|
|
T |
26217638 |
tccataattcaaa |
26217626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 759 times since January 2019
Visitors: 6131