View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_108 (Length: 214)
Name: NF0841_low_108
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_low_108 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 25713662 - 25713867
Alignment:
Q |
13 |
ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccctc-- |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
25713662 |
ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccccctc |
25713761 |
T |
 |
Q |
111 |
--atgcacctcatcatcttatcttttgtgcttctttgatccatcttttaaaaggagacattttgaaatattgactctatgtcttttataatatctagcca |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
25713762 |
atatgcacctcatcatcttatcttttgtgcttctttgatccatcttttaaaaggagatattttgaaatattgactttatgtcttttataatatctagcca |
25713861 |
T |
 |
Q |
209 |
atttta |
214 |
Q |
|
|
|||||| |
|
|
T |
25713862 |
atttta |
25713867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University