View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_109 (Length: 211)
Name: NF0841_low_109
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_low_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 25713662 - 25713725
Alignment:
Q |
13 |
ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacct |
76 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25713662 |
ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacct |
25713725 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University