View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_110 (Length: 211)
Name: NF0841_low_110
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_110 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 13 - 79
Target Start/End: Original strand, 25713662 - 25713728
Alignment:
| Q |
13 |
ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacctttg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25713662 |
ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacctttg |
25713728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University