View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_27 (Length: 468)

Name: NF0841_low_27
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_27
NF0841_low_27
[»] chr5 (2 HSPs)
chr5 (215-456)||(33112816-33113057)
chr5 (37-87)||(33112647-33112697)
[»] chr2 (1 HSPs)
chr2 (225-283)||(21562499-21562557)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 215 - 456
Target Start/End: Original strand, 33112816 - 33113057
Alignment:
215 ttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatttctttca 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33112816 ttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatttctttca 33112915  T
315 tatgatatgaatgtgtattctttatatgtgttttaatttaatttctatgtacatacgtttctgtttaacactctgtacaacnnnnnnnnnnncctatggt 414  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||| |    
33112916 tatgatatgaatgtgtattctttatatgtgttttaatttaatttctatgtacatacgtttctgtttaacactctgtacaacaacaaaaaaaacctatgct 33113015  T
415 tctctcttttgttaaacaagttcaatttttctataccatatt 456  Q
    ||||||||||||||||||||||||||||||||||||||||||    
33113016 tctctcttttgttaaacaagttcaatttttctataccatatt 33113057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 33112647 - 33112697
Alignment:
37 gttttcctatgtttcaatctctcatgttatcaaccatttgtctatgtaaca 87  Q
    |||||||||||||||||||||||||||||||||||||| |||||| |||||    
33112647 gttttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca 33112697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 21562557 - 21562499
Alignment:
225 tgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgata 283  Q
    |||||| ||||||||||||||||||||||| || ||||||||||| || ||||| ||||    
21562557 tgcaggagtcatatctggggctcttttgtatataagagatgattttaaggctgtggata 21562499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1409 times since January 2019
Visitors: 6140