View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_38 (Length: 426)
Name: NF0841_low_38
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0841_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 293; Significance: 1e-164; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 97 - 413
Target Start/End: Complemental strand, 13726207 - 13725891
Alignment:
Q |
97 |
acttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctttcttacattggacttttgatgtctccaagagttttggaatccctgttgctgtt |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
T |
13726207 |
acttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctttcttaaattggacttttgatgtctctaagagttttgaaatccctgttgctgtt |
13726108 |
T |
 |
Q |
197 |
ttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattgagttgccaatttcgaagagtgaaattgtgttacctggat |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
13726107 |
ttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattgagttgccgatttcgaagagtgaaattgtgttacctggat |
13726008 |
T |
 |
Q |
297 |
tgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaattttcaaagattga |
396 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
13726007 |
tgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaattttccaagattga |
13725908 |
T |
 |
Q |
397 |
tcaagctgattgggttc |
413 |
Q |
|
|
||||| ||||||||||| |
|
|
T |
13725907 |
tcaagttgattgggttc |
13725891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 187 - 413
Target Start/End: Complemental strand, 13697093 - 13696867
Alignment:
Q |
187 |
tgttgctgttttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattgagttgccaatttcgaagagtgaaattgtg |
286 |
Q |
|
|
|||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||| | |||| | || || || | | | ||| ||||||||| |
|
|
T |
13697093 |
tgttgctgtttttttaactcaagcttgttgtgttaatagtataaattttcatgcttttaagggatggttggatttacctttgttggagaaagaaattgtg |
13696994 |
T |
 |
Q |
287 |
ttacctggattgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaatttt |
386 |
Q |
|
|
|||||||||||||| | |||| ||| |||||||||||||||||| |||||| |||||||||| |||||||||||||||||||| | || |||||||||| |
|
|
T |
13696993 |
ttacctggattgcctaagcttgaagctgctgatttgccttcttttttgtataaatatggaactcatcctggttactttgatattttgactaaccaatttt |
13696894 |
T |
 |
Q |
387 |
caaagattgatcaagctgattgggttc |
413 |
Q |
|
|
||| ||||||||||| ||||||||||| |
|
|
T |
13696893 |
caatgattgatcaagttgattgggttc |
13696867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 317 - 366
Target Start/End: Original strand, 13686840 - 13686889
Alignment:
Q |
317 |
gatttgccttctttcttgtatcaatatggaacctatcctggttactttga |
366 |
Q |
|
|
||||||||||||||||||||| |||||||| ||||||| || |||||||| |
|
|
T |
13686840 |
gatttgccttctttcttgtataaatatggatcctatccgggatactttga |
13686889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 409
Target Start/End: Complemental strand, 13673072 - 13672980
Alignment:
Q |
317 |
gatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaattttcaaagattgatcaagctgattgg |
409 |
Q |
|
|
|||||||||||||| |||||| |||||||| | ||||| || ||||||||||| || || ||||||||||| |||| | ||||||||||| |
|
|
T |
13673072 |
gatttgccttcttttttgtataaatatggatcttatccaggctactttgatatagttgtcaatcaattttcaaacattggtaaagctgattgg |
13672980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 13693304 - 13693341
Alignment:
Q |
317 |
gatttgccttctttcttgtatcaatatggaacctatcc |
354 |
Q |
|
|
||||||||||||||||||||| |||||||| ||||||| |
|
|
T |
13693304 |
gatttgccttctttcttgtataaatatggatcctatcc |
13693341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2602 times since January 2019
Visitors: 6164