View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_49 (Length: 369)
Name: NF0841_low_49
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 96 - 355
Target Start/End: Original strand, 1809289 - 1809550
Alignment:
| Q |
96 |
tttctttgctagaatattataaaaatggaatgtgagattgcatgagatgaatcgcgaaattatggatgcattctaatcaatct--cgcgcatgtgtatat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | || ||||| ||| |
|
|
| T |
1809289 |
tttctttgctagaatattataaaaatggaatgtgagattgcatgagatgaatcgcgaaattatggatgcattctaacaaatctcacacgtgtgtgtgtat |
1809388 |
T |
|
| Q |
194 |
atagtctaaactgtccaaaactcctgggtctgtctctatctatcgctggtgtgtcacgacctagttgttttaagcatagaggtcgttatttacatgtacc |
293 |
Q |
| |
|
|||| ||| |||||||||||||| ||| | ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
1809389 |
atagcctacactgtccaaaactcatggatttgtctctatctatcgttggtgtgtcacgacctagttattttaagcatagaggtcgttatgtacatgtacc |
1809488 |
T |
|
| Q |
294 |
tggtgttgagaagtttggttaccatgtagtctctagtagagagttggtcttgaggatggccc |
355 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1809489 |
tggtgttgagaagtttggttagcatgtagtctctagtagagagttggtcttgaggatggccc |
1809550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 47489550 - 47489610
Alignment:
| Q |
97 |
ttctttgctagaatattataaaaatggaatgtgagattgcatgagatgaatcgcgaaatta |
157 |
Q |
| |
|
||||||| ||| ||||| |||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
47489550 |
ttctttgttagtatattgtaaaaatggaatgtgaaattgcatgagatgaatggccaaatta |
47489610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2682 times since January 2019
Visitors: 6165