View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_56 (Length: 336)
Name: NF0841_low_56
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 101 - 309
Target Start/End: Original strand, 2384087 - 2384296
Alignment:
| Q |
101 |
ctattgatcaaacagactattcttgatcaggatccgtgtcatgtcttcatagaatgggtcggtgtttgatctttgagccgaggttactagttccaaatca |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||| |||| || ||||||||||||||||||||| ||| ||||||||||| | |
|
|
| T |
2384087 |
ctattgatcaaacagtgtattcttgatcaggatctgtgtcatgtctttgcggaataggccggtgtttgatctttgagccggtgttgctagttccaaaccg |
2384186 |
T |
 |
| Q |
201 |
g-aacacatacaatgtaatatttcaagtcaaaacaacataggaaaattccagaatctgtaatctaaacaattatgatagaatttcaactttgaaacatat |
299 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
2384187 |
ggaacacatacaatgtaatatttcaagtcaaaaccacataggaaaattcgagaatctgtaatctaaacaattataatagaatttcaactttgaaacatgt |
2384286 |
T |
 |
| Q |
300 |
tagagtataa |
309 |
Q |
| |
|
|||| ||||| |
|
|
| T |
2384287 |
tagaatataa |
2384296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University