View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_57 (Length: 335)

Name: NF0841_low_57
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_57
NF0841_low_57
[»] chr5 (1 HSPs)
chr5 (101-309)||(2384087-2384296)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 101 - 309
Target Start/End: Original strand, 2384087 - 2384296
Alignment:
101 ctattgatcaaacagactattcttgatcaggatccgtgtcatgtcttcatagaatgggtcggtgtttgatctttgagccgaggttactagttccaaatca 200  Q
    |||||||||||||||  ||||||||||||||||| ||||||||||||    |||| || |||||||||||||||||||||  ||| ||||||||||| |     
2384087 ctattgatcaaacagtgtattcttgatcaggatctgtgtcatgtctttgcggaataggccggtgtttgatctttgagccggtgttgctagttccaaaccg 2384186  T
201 g-aacacatacaatgtaatatttcaagtcaaaacaacataggaaaattccagaatctgtaatctaaacaattatgatagaatttcaactttgaaacatat 299  Q
    | |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |    
2384187 ggaacacatacaatgtaatatttcaagtcaaaaccacataggaaaattcgagaatctgtaatctaaacaattataatagaatttcaactttgaaacatgt 2384286  T
300 tagagtataa 309  Q
    |||| |||||    
2384287 tagaatataa 2384296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1264 times since January 2019
Visitors: 6138