View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_59 (Length: 324)
Name: NF0841_low_59
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 25 - 283
Target Start/End: Original strand, 33654209 - 33654467
Alignment:
| Q |
25 |
gtctgaaaccaaacttatatcagaagctgtttgagaattaaattgatattgcgatggtcgatcttgaatcatgaaagagtcgtcagctaaaatgcctttc |
124 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33654209 |
gtctgaaaccaaacttatatcaggagctgtttgagaattaaattgatattgcgatggtcgatcttgaatcatgaaagagtcgtcagctaaaatgcctttc |
33654308 |
T |
|
| Q |
125 |
ttgtttttctctacaggtaaataatctctagctgaggatgacacataatagctacccgattcattgtttctctgagataacaacaattcctcgttggtaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33654309 |
ttgtttttctctacaggtaaataatctctagctgaagatgacacataatagctacccgattcattgtttctctgagataacaacaattcctcgttggtaa |
33654408 |
T |
|
| Q |
225 |
ttttctttgtctgcatgaatgtagatccatccttcccttcgttgaaatattcaacacga |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33654409 |
ttttctttgtctgcatgaatgtagatccatccttcccttcgttgaaatattcaacacga |
33654467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 501 times since January 2019
Visitors: 6130