View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_66 (Length: 293)
Name: NF0841_low_66
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 30 - 285
Target Start/End: Complemental strand, 29607462 - 29607207
Alignment:
| Q |
30 |
tgtgcaccattctgtgaaacataaaatcataagattcgataaaagaagctttagcaagttttgccaagtcagagtacaatctgtctgataaagatcagat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607462 |
tgtgcaccattctgtgaaacataaaatcataagattcgataaaagaagctttagcaagttttgccaagtcagagtacaatctgtctgataaagatcagat |
29607363 |
T |
|
| Q |
130 |
gacaaagattgcatgaattcgttaatgcggcataatccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaggatattacc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29607362 |
gacaaagattgcatgaattcgttaatgcggcatgatccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaagatattacc |
29607263 |
T |
|
| Q |
230 |
gcactgggactgggtgctggtgacggtccttcatctgaactcattgtagtattatc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607262 |
gcactgggactgggtgctggtgacggtccttcatctgaactcattgtagtattatc |
29607207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2229 times since January 2019
Visitors: 6160